| HOME PAGE | Research |
Visualizations of nucleotide sequence
Visualizations of quaternary, ternary and quinary numeral systems Visualizations of nucleotide sequence Components of DNA DNA is a carrier of genetic information. Into its composition enter basic units which we call nucleotides. For their designation we use letters A G C T which indicate separate nucleobases: A - adenine
G - guanine
C - cytosine
T - thymine being the one from components of nucleotides besides monosaccharide pentose called deoxyribose and particles of phosphoric acid. An example of DNA segment: ATCCAAGCGCCCGCTAATTCTGTTCTGTTAATGTTCATACCAAGAACCGGC ................................................ Sequence of 744 nucleotides
GCGGCTTCCTACCTTTAGCTCCGAGTATAGTGAGGCCTAGATATGCGCGGGCAGGTAGCTACAGTGTATACATG
CTCGTTCTGCGGCATGCGGATATAAATTAAGGATAATACTCAAGTGTTCCAGGGGAGCAGTCATAAAGCACAAC
TTCATTATCCCTAAGCTCAGTTAATCTAAGCATGTTTAGCGCTAAGTCTCGTCTACGCGGCAAATACTTTGTAA
GCGTTTCTTTAACTTGCCGCTCTCAGAAGGGGCACGGCCGTCATTATGTAACAAGAACGAGTCTCTTACTGGTT
GTGCGAGTGGAATGGAGCAACGATGTACGTGTACCGGAAATTTCTAAGGTTTCCCGGCGTATCGATCAAGTCCA
GGTTACCGCCTCCCGACAAGGGTATGCTCAACATCCACTGCTGCTGTCCTACGCTCCCTTGGAGACCAATCCTG
CGTCATTCAAACTTCGAACATGCGCCGGCATTGTATGTTCATGCCGATAGTGGGTTCATGTTGTGTTATTTACA
TTCACTGAGTGGCTTCTGCATGTTTCTGGCTCGCCCGAGACTGATCACGCAAAAAATCTCAGAGATGAACTCAA
CTGTACCCGTATAATTGGACCAAAGCTGTCGCGCAGCCGTTACGTGCGTATAGTAAATCCAATTTGCTGCAAAT
TCAACAAAAAAGACAGGCTCACGATGCGACGATATTTTGATAATTTTCTAGCGGGCTCGGCCAGCGTACAGTGA
GAGTTTACTGGTGGCGGCGCTGCTAACACGAGTT
This type of sequence can be a recording of a single gene - an unit of heredity.
For example gene SD17 species Arabidopsis thaliana (thale cress)
has a size of 843 nucleotides and is coding Receptor-like serine/threonine-protein
kinase SD1-7. Gene ANP3 of the same species has a size of 651 nucleotides
and is coding Mitogen-activated protein kinase kinase kinase 3.
The visualization above, as well as the visualizations below, originate from the visualization of the quaternary numeral system.
................................................
Sequence of 215 nucleotides x 3
TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAG
TTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGA
TATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT
CCGGTATGAATTCTCCGCGCAATAAGCCATCTCCCTACCGCATTGCATCAAAGCATTTCACAGCAGTCCAGCCC
CGAGGTTCAGGGTCTCGGAGCTTCTGTCGACAGTAACAACCGGGTCGTGCCCGCCATCAATCGGTATCTTAAAT
AAATAGAAATCTTTAGAGGCCGGTGGTAATACAGTTAGATCGACATAGTAAATAGGCTCAGAACTA
CTACGTATAAGGCGCTCTGATTGACGAAATGAGAACTAGAGCAGTACCGGGGAGGTCTTGTTAACTACGTTATA
GGGAGCGCCCCTGCATTAACCCCCCCTGCGAGCTGTCATAGAAGCCCAATACGTGGACGTACCAATGAAGAGTA
ACGACTCTAGTAGCGTCATGTACCACATACCCGTACTCAGACACACACGGGTACGCGATTGAGCACG
................................................
Sequence of 5418 nucleotides
TACGGCACAGGTCGGTTCAATCCGTTTCCCCGGATCTCACGTCATAGGACCTATGAGTAGGTAGGTCTTAAAAGA
TAATGATTCTGAGGGCTATCACAGCATAATTATTTGTTACAGACGACATTCTCATATTTTCCTGCTTTGCAGGAA
AGAGTATTGAACCGCTGAGGAATTACCCACGTGTTGCCAGGCAAGAGACGGCCAGGAATCGCCACGGATTGGGCA
CATGACGTCGCGGACAACCCAGAATTGTCTTGAGCGATGGTAAGATCTAACCTCACTGCCGGGGGAGGCTCATAC
CTGGGGCTTTACTGATGTCATACCGTCTTGCACGGGGATAGAATGACGGTGCCCGTGTCTGCTTGCCTCGAAGCA
ATTTTCTGAAAGTTACAGACTTCGATTAAAAAGATCGGACTGCGCGTGGGCCCGGAGAGACATGCGTGGTAGTCA
TTTTTCGACGTGTCAAGGACTCAAGGGAATAGTTTGGCGGGAGCGTTACAGCTTCAATTCCCAAAGGTCGCAAGA
CGATAAAATTCAACTACTGGTTTCGGCCTAATAGGTCACGTTTTATGTGAAATAGAGGGGAACCGGCTCCCAAAT
CCCTGGGTGTTCTATGATAAGTCCTGCTTTATAACACGGGGCGGTTAGGTTAAATGACTCTTCTATCTTATGGTG
ATCCAAGCGCCCGCTAATTCTGTTCTGTTAATGTTCATACCAATACTCACATCACATTAGATCAAAGGATCCCCG
AGCCCAGTCGCAAGGGTCTGCTGCTGTTGTCGACGCCTCATGTTACTCCTGGAATCTACCTGCCCTCCCCTCACC
GGTTAAGGCGTGTGATCGACGATGCAGGTATACATCGGCTCGGACCTACAGTGGTCGATCGACTGGCTACTGGCT
TCGCGGTTCGGCGCGTAGTTGAGTGCGATAACCCAACCGGTGGCAAGTAGCAAGAAGACCTACCTGGGTCACCTT
AGACAACCTAACTAATAGTCTCTAACGGGGAATTACCTTTACCAGTCTCATGCCTCCAATATATCTGCACCGCTT
CAATGATATCGCCCACAGAAAGTAGGGTCTCAGGTATCGCATACGCCGCGCCCGGGTCCCAGCTACGCTCAGGAC
GACAGTAGAGAGCTATTGTGTAATTCAGGCTCAGCATTCATCGACCTTTCCTGTTGTGAATATTGTGCTAATGCA
TCTCGTCCGTAACGATCTGGGGGGCAAAACCGAATATCCGTATTCTCGTCCTACGGGTCCACAATGAGAAAGTCC
TGCGCGTGATCGTCAGTTAAGTTAAATTAATTCAGGCTACGGTAAACTTGTAGTGAGCTAAGAATCACGGGAATC
ACGGGTTCGCTACAGATGAACTGAATTTATACACGGACAACTCATCGCCCATTTGGGCGTGGGCACCGCAGATCA
AAAGTGGCAGATTAGGAGTGCTTGATCAGGTTAGCAGGTGGACTGTATCCAACAGCGCATCAAACTTCAATAAAT
CCAAAGCGTTGTAGTGGTCTAAGCACCCCTGAACAGTGGCGCCCATCGTTAGCGTAGTACAACCCTTCCCCCTTG
AGGTGCGACATGGGGCCAGTTAGCCTGCCCTATATCCCTTGCACACGTTCAATAAGAGGGGCTCTACAGCGCCGC
TTTTTAAATTAGGATGCCGACCCCATCATTGGTAACTGTATGTTCATAGATATTTCTTCAGGAGTAATAGCGACA
AGCTGACACGCAAGGGTCAACAATAATTTCTACTATCACCCCGCTGAACGACTGTCTTTGCAAGAACCAACTGGG
CTTAGATTCGCGTCCTAACGTAGTGAGGGCCGAGTCATATCATAGATCAGGCATGAGAAACCGACGTCGAGTCTA
CACACGAGTTGTAAACAACTTGATTGCTATACTGTAGCTACCGCAAGGATCTCCTACATCAAAGACTACTGGGCG
ATCTGGATCCGAGTCAGAAATACGAGTTAATGCAAATTTACGTAGACCGGTGAAAACACGTGCCATGGGTTGCGT
AGACCGTAGTCAGAAGTGTGGCGCGCTATTCGTACCGAACCGGTGGAGTATACAGAATTGCTCTTCTACGACGTA
AGGAGCTCGGTCCCCAATGCACGCCAAAAAAGGAATAAAGTATTCAAACTGCGCATGGTCCCTCCGCCGGTGGCA
CTATTATCCATCCGAACGTTGAACCTACTTCCTCGGCTTATGCTGTCCTCAACAGTATCGCTTATGAATCGCATG
CGGCTGTGGATCTTAACGGCCACATTCTTAATTCCGACCGATCACCGATCGCCTTTCCTCGCTGGTACAATGAGT
ACTAAGTTATCCAGATCAAGGTTTGAACGGACTCGTATGACATGTGTGACTGAACCCGGGAGGAAATGCAGAGAA
CTGTTTCAAGGCCTCTGCTTTGGTATCACTCAATATATTCAGACCAGACAAGTGGCAAAATTTCGTGCGCCTCTC
CTAGGTATTCACGCAACCGTCGTAACATGCACTAAGGATAACTAGCGCCAGGGGGGCATACTAGGTCCCGGAGCT
AAAGACTACCCTATGGATTCCTTGGAGCGGGGACAATGCAGACCGGTTACGACACAATTATCGGGATCGTCTAGA
GGTATTATTAGCAAGACAATAAAGGACATTGCACAGAGACTTATTAGAATTCAACAAACAGGATCATATCATGCG
GTGTTGGGTCGGGCAAGTCCCCGAAGCTCGGCCAAAAGATTCGCCATGGAACCGTCTGGTCCTGTTAGCGTGTAC
GCCTGCTCCTGTTCCGGGTACCATAGATAGACTGAGATTGCGTCAAAAAATTGCGGCGAAAATAGAGGGGCTCCT
TGTAGAAATACCAGACTGGGGAATTTAAGCGCTTTCCACTATCTGAGCGACTAAACATCAACAAATGCGTCTACT
CGAATCCGCAGTAGGCAATTACAACCTGGTTCAGATCACTGGTTAATCAGGGATGTCTTCATAAGATTATACTTG
CCCCGACGCGACAGCTCTTCAAGGGGCCGATTTTTGGACTTCAGATACGCTAGAATTTAAAGGGTCTCTTACACC
TGCTGCGGCCTGCAGGGACCCCTAGAACTTGCCGCCTACTTGTCTCAGTCTAATAACGCGCGAAGCCGTGGGGCA
CGTGACCTTAAGTCGCAGAGCGAGTGATGAATTTGGGACGCTAATATGGGTGAATAGAGACTTATATCATCAGGG
CATGAACACTGTCTAGAAGATAAGCCCTAGGTTTCCTTCTCAAGGCATGGTCGTGTTACCGTATGTGCGCTCTAA
AACAACCGATCGCATGTGGGCGGGGACGTAAAGGCAATGTAAAAGCGAAGGACTGTCTGAGTGCAAAACGCAAAC
TACATTCCATGTTTACACCGCGAACTATCCACGCACTATGGTTCCCTTTTCACTGATTGTGCCGAGTATAGAGTA
CCTCGAGAACGGAAACTTGTCTGAACGCCATGATCGTAATAGCGGTCGAAAAAAGGGACATAAAAGATCCCTCAT
TGAAGACTAGATAGCATACAGGTGTAACAAACCGATACACCTAAACGTGTGGGCAGAATTTCTCATTCCCCACCG
CAGGGACGGAACTCCGTTCGAAATTAACATACCGCATGTCGCGTGTTCAAAGGGAGCACATCCTAACCCACCTAT
CCTACCCGGTTGCAACCCCGAACCTCAACTGAATGGCGATCAACGCTTCGTTAGCCGCTCACGTGTGGCGGGAGA
GGATCGCCCAACTTTGGAAGACCTGTCTCTGTGCGCTCTATACTCCTAGGTTTATTCAATGCGCCAAAAACCATC
GGCACGTACGATTAAACGACGAGCCCGACGGGGAACCTTTAAGCCATCCTTGTTATTGCAGTAGCTCAGTACTTG
CACGTGATGGGGCGCGTACACTGGAGACACGTCTTGATATTTAAACCTTGCTCCAGCCCGGCTACAGCAGAAGAC
CGCAACAGTCGTGCTGACCAGTTAGAAAGATGATATGTGCGCAGCTTTTAACAGGGTGCCCCGTGGAACAGTCCT
GTCGACTACAAAGGATGCGTTATCAGTCCCACCATCTCAGCGTGTTCGCCCATTACTAAGCTACACGGCGCAATA
GCGGGGGACGCGCCGCCCCCCGATAACGATCATGTTGGGTAGGGACAGTCACAACGGTCTCCTGTTTACTAACAA
TTCATGTCAACACGCCATCTTACATGGTGTGACTGTCTAAGGGGCGGGCGGTTTCCTACAACTCCGAAGTAATTC
CCTCTGTCAGTATCACAGATGCCAAAGAATTCTATCTGAACCAGCACAGCTAAAATACATGCTCCGTAGGCCACT
TTCGCAAATCCAAATGCGATAATTTATCTTAAGACTGCATCTGCAAACCCAGGCCCGGGGTGATAGCTCTCATCT
GAATATAACGTGTGCCAAAGCGCGTGGCCGAGCTCATTTCAAGCCAACATTCGCATGTCGTGGAAGTTCGTCACC
AGGCCATAGATACTTACATAAGCCGGAAAGTACACCATCAGGCGAGCTAGTCATCACGGTTACTGGGGATTCATG
CGTGGCGACTGTTCCAAAAGTTGCCATACGGCAGGACCTTTTATTTTCTGGTACAGACGTCACCGCAATCTTCTA
ACTACTAACGGCGCTAAAACTCTGCGCAAGTCAGTTGGGTCTTTCTATGATATAACATGTCGTAACTGACATTAA
GAGTTGCGCGTATAACTGCGAATAGACTGCATAGCTCGTCCTAGAACTATCATGGTGTACGGCATCGCTCTGACA
CTTATTATTCTTGGCTCTGGCTTAATATCCCCGTCGATCCCAGCGTCTCCAAGTCGTACTTCCGTGGTTGTCATC
TCATTCCCAGAGTGCGGGTCAGCGAATATCTTACGTACCCCTGCCGAAGTCGTACCCCCGAGCTTCGGTATCTCA
TATAGTGTCGGCGGCACGACTGGGCTCGGGAGCTCGGAAGTTGGATAAATCATATGTGACGAGTCCAGAAAGTTC
AGTATAGCCTTGGTGTTTCCAATGGTTCTCATGTCGTGGCCGAAGTCGAGCTCCTCTTAGCCCGCAGGAACAAAC
GAGGGCTACGTACAGGGTTGTCAGTGTAATTAAAGTATCGCCGAGACTCTAGTCGGCAGAGAAACCAGTTGGCCT
GTTCCCTTCTCTACCCGACCCTCTTACTTGTGATAATATGTACAAATTACCCGGAAAATAGAGTCGCAAATCAGA
CGGCAGAAGTCGTAGTATCAGTTTATTTATTTTATCATTGACTCTGGCCGTAGTACTTTTTCGTCGGTTACCCCC
TGCTGATCCTGAAACGAACCCACACGAAAGTTCTAGCGAAACAGCGGATCTGCGCCCCGTTTTGGGTACGGTGTA
ATTGTACGCCTGAACTGA
This type of sequence can be a recording of some number of genes or the genome of virus.
................................................
download Visualizations SequencesN application
................................................
Visualizations of quaternary, ternary and quinary numeral systems
Quaternary numeral system
910, 268, 279, 395, 987, 796, 987, 363, 188, 967, 133, 705, 709, 119, 423, 774, 804, 866, 777, 875, 568, 329, 495, 241, 427, 186, 337, 107, 579, 1002, 720, 480, 668, 775, 513, 967, 240, 490, 191, 887, 806, 298, 67
32032, 10030, 10113, 12023, 33123, 30130, 33123, 11223, 02330, 33013, 02011, 23001, 23011, 01313, 12213, 30012, 30210, 31202, 30021, 31223, 20320, 11021, 13233, 03301, 12223, 02322, 11101, 01223, 21003, 33222, 23100, 13200, 22130, 30013, 20001, 33013, 03300, 13222, 02333, 31313, 30212, 10222, 01003
Recalculating of decimal numeral system to quaternary numeral system:
395, 12023
4^4 + 4^3 + 4^2 + 4^1 + 4^0
256 + 64 + 16 + 4 + 1
1 + 2 + 0 + 2 + 3
256 + 128 + 0 + 8 + 3 (=395)
676, 142, 34, 945, 80, 727, 211, 799, 480, 926, 998, 565, 688, 269, 518, 132, 212, 467, 326, 638, 1019, 620, 296, 612, 425, 221, 815, 953, 610, 361, 29, 590, 137, 938, 786, 701, 669, 112, 214, 852, 895, 489, 587, 341, 121, 125, 619, 895, 425, 960, 224, 978, 663, 2, 878, 891, 399, 466, 370, 216, 375, 511, 384, 135, 726, 373, 632, 874, 442, 356, 553, 159, 800, 311, 179, 827, 427, 172, 237, 238, 563, 408, 735, 827, 515, 442, 674, 635, 348, 521, 690, 610, 497, 508, 520, 280, 539, 555, 778, 707, 605, 709, 411, 138, 4, 842, 871, 727, 114, 493, 685, 0, 488, 544, 164, 268, 863, 684, 443, 953, 569, 206, 738, 400, 355, 700, 1022, 251, 689
22210, 02032, 00202, 32301, 01100, 23113, 03103, 30133, 13200, 32132, 33212, 20311, 22300, 10031, 20012, 02010, 03110, 13103, 11012, 21332, 33323, 21230, 10220, 21210, 12221, 03131, 30233, 32321, 21202, 11221, 00131, 21032, 02021, 32222, 30102, 22331, 22131, 01300, 03112, 31110, 31333, 13221, 21023, 11111, 01321, 01331, 21223, 31333, 12221, 33000, 03200, 33102, 22113, 00002, 31232, 31323, 12033, 13102, 11302, 03120, 11313, 13333, 12000, 02013, 23112, 11311, 21320, 31222, 12322, 11210, 20221, 02133, 30200, 10313, 02303, 30323, 12223, 02230, 03231, 03232, 20303, 12120, 23133, 30323, 20003, 12322, 22202, 21323, 11130, 20021, 22302, 21202, 13301, 13330, 20020, 10120, 20123, 20223, 30022, 23003, 21131, 23011, 12123, 02022, 00010, 31022, 31213, 23113, 01302, 13231, 22231, 00000, 13220, 20200, 02210, 10030, 31133, 22230, 12323, 32321, 20321, 03032, 23202, 12100, 11203, 22330, 33332, 03323, 22301
781, 744, 537, 929, 684, 145, 490, 282, 296, 259, 450, 24, 402, 821, 450, 751, 747, 530, 728, 269, 787, 458, 788, 335, 590, 53, 332, 268, 534, 434, 839, 941, 750, 256, 678, 984, 479, 365, 414, 11, 850, 991, 479, 417, 505, 26, 171, 571, 371, 179, 114, 102, 348, 303, 264, 377, 639, 682, 182, 939, 208, 129, 333, 50, 483, 873, 369, 619, 150, 631, 837, 528, 909, 608, 689, 826, 332, 145, 613, 81, 374, 105, 989, 700, 20, 542, 895, 77, 99, 938, 787, 81, 507, 321, 446, 69, 1007, 946, 438, 258, 668, 45, 213, 629, 465, 469, 583, 177, 521, 669, 122, 608, 95, 458, 894, 386, 496, 924, 281, 91, 88, 652, 156, 400, 511, 894, 461, 862, 484
30031, 23220, 20121, 32201, 22230, 02101, 13222, 10122, 10220, 10003, 13002, 00120, 12102, 30311, 13002, 23233, 23223, 20102, 23120, 10031, 30103, 13022, 30110, 11033, 21032, 00311, 11030, 10030, 20112, 12302, 31013, 32231, 23232, 10000, 22212, 33120, 13133, 11231, 12132, 00023, 31102, 33133, 13133, 12201, 13321, 00122, 02223, 20323, 11303, 02303, 01302, 01212, 11130, 10233, 10020, 11321, 21333, 22222, 02312, 32223, 03100, 02001, 11031, 00302, 13203, 31221, 11301, 21223, 02112, 21313, 31011, 20100, 32031, 21200, 22301, 30322, 11030, 02101, 21211, 01101, 11312, 01221, 33131, 22330, 00110, 20132, 31333, 01031, 01203, 32222, 30103, 01101, 13323, 11001, 12332, 01011, 33233, 32302, 12312, 10002, 22130, 00231, 03111, 21311, 13101, 13111, 21013, 02301, 20021, 22131, 01322, 21200, 01133, 13022, 31332, 12002, 13300, 32130, 10121, 01123, 01120, 22030, 02130, 12100, 13333, 31332, 13031, 31132, 13210
The alien (cosmic) signs forming in the above images are derived from an alien numeral system. An interesting fact is that these alien signs are formed out of chance, a random process. This is an example of order emerging from random process.In the case of these signs, chance speaks to us in some alien language. Let me describe this language as the language of God the Superfather (cosmoses). So in the case of this visualization, chance speaks to us in the language of God the Superfather.
The chance undergoes ordering processes, hence it may, under certain conditions, lead to the emergence of order. Similarly, chaos undergoes ordering processes and leads to the emergence of order. An example are fractals.
I propose replacing the current 26 characters Latin alphabet with a new set of 26 characters. You can use my app for this purpose (see below 3 rows app). The new signs would correspond to the old sounds, only the letter writing would change. In this way, our language would become similar to the language of God the Superfather. (The above paragraph is from year 2023 and 2024) ................................................ Ternary numeral system
34, 158, 217, 39, 233, 161, 234, 202, 137, 88, 53, 177, 44, 222, 71, 157, 118, 233, 138, 53, 9, 200, 237, 92, 156, 57, 67, 46, 209, 173, 163, 110, 22, 16, 225, 134, 8, 143, 55, 89, 122, 11, 126
01021, 12212, 22001, 01110, 22122, 12222, 22200, 21111, 12002, 10021, 01222, 20120, 01122, 22020, 02122, 12211, 11101, 22122, 12010, 01222, 00100, 21102, 22210, 10102, 12210, 02010, 02111, 01201, 21202, 20102, 20001, 11002, 00211, 00121, 22100, 11222, 00022, 12022, 02001, 10022, 11112, 00102, 11200
Recalculating of decimal numeral system to ternary numeral system:
143, 12022
3^4+ 3^3+ 3^2+ 3^1+ 3^0
81 + 27 + 9 + 3 + 1
1 + 2 + 0 + 2 + 2
81 + 54 + 0 + 6 + 2 (=143)
217, 180, 204, 230, 6, 121, 33, 60, 34, 12, 159, 103, 108, 60, 192, 160, 142, 191, 0, 228, 233, 214, 45, 206, 46, 188, 50, 127, 64, 188, 237, 24, 59, 204, 67, 65, 116, 214, 70, 195, 166, 85, 102, 45, 99, 189, 226, 149, 172, 68, 110, 30, 10, 66, 105, 142, 170, 206, 241, 173, 89, 141, 217, 111, 114, 175, 110, 97, 135, 11, 159, 231, 197, 189, 209, 135, 97, 107, 184, 37, 86, 107, 124, 147, 19, 201, 61, 222, 184, 133, 91, 66, 61, 238, 65, 99, 48, 198, 94, 198, 111, 86, 230, 156, 37, 210, 120, 106, 199, 155, 42, 24, 133, 187, 131, 148, 16, 210, 22, 103, 38, 52, 234, 148, 209, 21, 112, 40, 86
22001, 20200, 21120, 22112, 00020, 11111, 01020, 02020, 01021, 00110, 12220, 10211, 11000, 02020, 21010, 12221, 12021, 21002, 00000, 22110, 22122, 21221, 01200, 21122, 01201, 20222, 01212, 11201, 02101, 20222, 22210, 00220, 02012, 21120, 02111, 02102, 11022, 21221, 02121, 21020, 20011, 10011, 10210, 01200, 10200, 21000, 22101, 12112, 20101, 02112, 11002, 01010, 00101, 02110, 10220, 12021, 20022, 21122, 22221, 20102, 10022, 12020, 22001, 11010, 11020, 20111, 11002, 10121, 12000, 00102, 12220, 22120, 21022, 21000, 21202, 12000, 10121, 10222, 20211, 01101, 10012, 10222, 11121, 12110, 00201, 21110, 02021, 22020, 20211, 11221, 10101, 02110, 02021, 22211, 02102, 10200, 01210, 21100, 10111, 21100, 11010, 10012, 22112, 12210, 01101, 21210, 11110, 10221, 21101, 12202, 01120, 00220, 11221, 20221, 11212, 12111, 00121, 21210, 00211, 10211, 01102, 01221, 22200, 12111, 21202, 00210, 11011, 01111, 10012
................................................
Quinary numeral system
1029, 1070, 2715, 2857, 18, 53, 942, 1189, 2699, 74, 879, 2627, 395, 2874, 1748, 1962, 299, 511, 2850, 2504, 2177, 840, 320, 2764, 2656, 331, 1768, 749, 103, 444, 2533, 5, 1988, 2111, 2386, 2323, 3076, 1097, 1704, 928, 356, 1601, 1290
13104, 13240, 41330, 42412, 00033, 00203, 12232, 14224, 41244, 00244, 12004, 41002, 03040, 42444, 23443, 30322, 02144, 04021, 42400, 40004, 32202, 11330, 02240, 42024, 41111, 02311, 24033, 10444, 00403, 03234, 40113, 00010, 30423, 31421, 34021, 33243, 44301, 13342, 23304, 12203, 02411, 22401, 20130
Recalculating of decimal numeral system to quinary numeral system:
1704, 23304
5^4+ 5^3+ 5^2+ 5^1+ 5^0
625 + 125 + 25 + 5 + 1
2 + 3 + 3 + 0 + 4
1250 + 375 + 75 + 0 + 4 (=1704)
................................................
download Visualizations NumeralS application
download Visualizations NumeralS 3 rows in the same system, application
................................................
Gregory Podgorniak, Poland (year 2015 nucleotide sequence, year 2010 numeral systems)
Comte's Theory of Science
According to him whole of sciences consists of theoretical and applied knowledge. Theoretical
knowledge divide on general fields as physics or biology, which are an object of his research and detailed
such as botany, zoology or mineralogy. Main fields mathematics, astronomy, physics, chemistry,
biology and sociology it is possible to order according to decrescent range of research and
complicatedness of theoretical tools what is connected with growing complexity of investigated
phenomenones. Following sciences are based on previous, for example to methodically capture chemistry,
we must imply acquaintance of physics, because all chemical phenomena are more complicated than
physical phenomena, are also from them dependent and themselves do not have on them an influence.
Similarly sciences classified as earlier, are older and more advanced from these which are presented
as later. This theory is clearly analogous to Mariotte's Law.
Mariotte's Law
Edme Mariotte (1620-1684) French physicist, meteorologist, physiologist. He initiated meteorological
research and measurement. In his Discourse on the Nature of Air (1676) coined the word barometer
and formulate basic tenet of physics called Mariotte's law states that at constant temperature T
volume V of a given quantity of gas is inversely proportional as its pressure
p:
pV = constant
its graph is hyperbole:
pV = const = nrT
p = rT / V
about the author, My name is Gregory Podgorniak (brn. 01.1977, Szczecinek, West Pomerania, Poland). I am working
on field of natural as well as social sciences. During philosophical studies at Adam Mickiewicz University in Poznan (1996-1999)
I was actively act in student scientific organisation, got a scientific scholarship, and one from my articles titled Circulus vitiosus and fourfold petitio principii in the system of Descartes was published in Humanistic Drafts of Publishing House of Humaniora Foundation in Poznan, no. 6, 1998. Unfortunately certain fate events
made impossible to me continuing studies to master's and later doctor's degree. Thence I was forced to be content only with a title of bachelor.Thanks to deep and penetrating researchings I was able to establish indisputably some number of my past incarnations reaching of ancient period, these data are certain, these incarnations are: Auguste Comte (1798-1857) French philosopher and sociologist, Edme Mariotte (1620-1684) French physicist and meteorologist, Bodhidharma (5th or 6th century) buddhist patriarch, Aenesidemus (1 st century BC) Greek sceptical philosopher, Arcesilaus (315-241 BC) Greek sceptical philosopher, Gorgias (485-380 BC) Greek sophist. email contact: podgorniakgre@gmail.com appendix 1
Photograph of the subtle body obtained using a special UV filter, the author of the photo probably was not aware of the obtained result. I discovered this photo by accident, by searching images of ultraviolet photography, around the year 2005. Colors are different than on photographs in visible light what is natural for UV photography. This photo is proof of the existence of the soul.
appendix 2
Solution of the problem of Wave-particle duality
One of the biggest puzzles is the problem of how light in classical physics can be a wave, while in quantum physics it is in the form of photons or particles. The light ray is a wave but the energy transmits matter in the form of photons. Thus, it can also be assumed that any other particle, for example a moving electron, can be a wave of matter. The existence of matter waves was confirmed in 1927. Also in 1927 the uncertainty principle was formulated, stating that it is impossible to measure the position and momentum of a particle with unlimited accuracy. The issues considered are related to the problem of wave-particle duality.Wave-particle duality, the property of matter, for example electrons, in that in some conditions the wave character is manifested, and in others corpuscular character. Wave properties are revealed by diffraction and interference phenomena. Classical physics could not explain, for example, the photoelectric phenomenon, the adoption of the concept of a discrete radiation structure enabled solving this difficulty. Electron diffraction has shown that molecules have wave properties in addition to their corpuscular properties. Current theory assumes that all molecules have both wave and corpuscular character. This fact has been checked not only for elementary particles but also for composite particles such as atoms. Recognition of the dual nature of matter is the basis of modern physics.
So far, considered duality remains a mystery, this is my explanation of this enigma. The problem of wave-particle duality is in fact a problem of trichotomy, where the third state are fields. At the explanation of this problem it is possible to invoke phenomenon of three states of concentration of the matter, the solid state, liquid and gas. This phenomenon determines the model for the problem of trichotomy in the microworld. Three states of concentration of the matter it is possible to implement by the fourth state which is the vacuum. These considerations make for the conclusion that the base for three states of the microworld is the vacuum. So particles, waves and fields are just a condensed form of vacuum (space). On the ground of STM (see paragraph 1) we can reach explanation where particles, waves and fields can be brought to the space.
The vacuum or space itself is in three states, the firstfruits of particle, wave and field matter. First we have the firstfruits of particle matter, the square microgrid, which is what the particles are made of. Later we have the firstfruits of wave matter - asymmetric microgrid, waves are made of it. Then the firstfruits of field matter, straight parallel lines, from which the fields are composed. It can be said that these firstfruits of fields are themselves a field, and the vacuum (space) itself is a field.
So it appears that matter is simply of a threefold nature, because the space from which it arises has a threefold nature. There are three microgrids, a particle microgrid, a wave microgrid, and a field microgrid. more in my text: New horizons in physics map of my research
