HOME PAGE | Research

The text consists of two parts:
Visualizations of nucleotide sequence
Visualizations of quaternary, ternary and quinary numeral systems

Visualizations of nucleotide sequence

Components of DNA

DNA is a carrier of genetic information. Into its composition enter basic units which we call nucleotides. For their designation we use letters A G C T which indicate separate nucleobases:

A - adenine
G - guanine
C - cytosine
T - thymine

being the one from components of nucleotides besides monosaccharide pentose called deoxyribose and particles of phosphoric acid.

An example of DNA segment: ATCCAAGCGCCCGCTAATTCTGTTCTGTTAATGTTCATACCAAGAACCGGC

................................................

Sequence of 744 nucleotides

Sequence of 744 nucleotides

GCGGCTTCCTACCTTTAGCTCCGAGTATAGTGAGGCCTAGATATGCGCGGGCAGGTAGCTACAGTGTATACATG CTCGTTCTGCGGCATGCGGATATAAATTAAGGATAATACTCAAGTGTTCCAGGGGAGCAGTCATAAAGCACAAC TTCATTATCCCTAAGCTCAGTTAATCTAAGCATGTTTAGCGCTAAGTCTCGTCTACGCGGCAAATACTTTGTAA GCGTTTCTTTAACTTGCCGCTCTCAGAAGGGGCACGGCCGTCATTATGTAACAAGAACGAGTCTCTTACTGGTT GTGCGAGTGGAATGGAGCAACGATGTACGTGTACCGGAAATTTCTAAGGTTTCCCGGCGTATCGATCAAGTCCA GGTTACCGCCTCCCGACAAGGGTATGCTCAACATCCACTGCTGCTGTCCTACGCTCCCTTGGAGACCAATCCTG CGTCATTCAAACTTCGAACATGCGCCGGCATTGTATGTTCATGCCGATAGTGGGTTCATGTTGTGTTATTTACA TTCACTGAGTGGCTTCTGCATGTTTCTGGCTCGCCCGAGACTGATCACGCAAAAAATCTCAGAGATGAACTCAA CTGTACCCGTATAATTGGACCAAAGCTGTCGCGCAGCCGTTACGTGCGTATAGTAAATCCAATTTGCTGCAAAT TCAACAAAAAAGACAGGCTCACGATGCGACGATATTTTGATAATTTTCTAGCGGGCTCGGCCAGCGTACAGTGA GAGTTTACTGGTGGCGGCGCTGCTAACACGAGTT

This type of sequence can be a recording of a single gene - an unit of heredity. For example gene SD17 species Arabidopsis thaliana (thale cress) has a size of 843 nucleotides and is coding Receptor-like serine/threonine-protein kinase SD1-7. Gene ANP3 of the same species has a size of 651 nucleotides and is coding Mitogen-activated protein kinase kinase kinase 3.

The visualization above, as well as the visualizations below, originate from the visualization of the quaternary numeral system.

................................................

Sequence of 215 nucleotides x 3

Sequence of 215 nucleotides x 3

TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAG TTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGA TATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT

CCGGTATGAATTCTCCGCGCAATAAGCCATCTCCCTACCGCATTGCATCAAAGCATTTCACAGCAGTCCAGCCC CGAGGTTCAGGGTCTCGGAGCTTCTGTCGACAGTAACAACCGGGTCGTGCCCGCCATCAATCGGTATCTTAAAT AAATAGAAATCTTTAGAGGCCGGTGGTAATACAGTTAGATCGACATAGTAAATAGGCTCAGAACTA

CTACGTATAAGGCGCTCTGATTGACGAAATGAGAACTAGAGCAGTACCGGGGAGGTCTTGTTAACTACGTTATA GGGAGCGCCCCTGCATTAACCCCCCCTGCGAGCTGTCATAGAAGCCCAATACGTGGACGTACCAATGAAGAGTA ACGACTCTAGTAGCGTCATGTACCACATACCCGTACTCAGACACACACGGGTACGCGATTGAGCACG

................................................

Sequence of 5418 nucleotides

DNA sequence - 5418 nucleotides

TACGGCACAGGTCGGTTCAATCCGTTTCCCCGGATCTCACGTCATAGGACCTATGAGTAGGTAGGTCTTAAAAGA TAATGATTCTGAGGGCTATCACAGCATAATTATTTGTTACAGACGACATTCTCATATTTTCCTGCTTTGCAGGAA AGAGTATTGAACCGCTGAGGAATTACCCACGTGTTGCCAGGCAAGAGACGGCCAGGAATCGCCACGGATTGGGCA CATGACGTCGCGGACAACCCAGAATTGTCTTGAGCGATGGTAAGATCTAACCTCACTGCCGGGGGAGGCTCATAC CTGGGGCTTTACTGATGTCATACCGTCTTGCACGGGGATAGAATGACGGTGCCCGTGTCTGCTTGCCTCGAAGCA ATTTTCTGAAAGTTACAGACTTCGATTAAAAAGATCGGACTGCGCGTGGGCCCGGAGAGACATGCGTGGTAGTCA TTTTTCGACGTGTCAAGGACTCAAGGGAATAGTTTGGCGGGAGCGTTACAGCTTCAATTCCCAAAGGTCGCAAGA CGATAAAATTCAACTACTGGTTTCGGCCTAATAGGTCACGTTTTATGTGAAATAGAGGGGAACCGGCTCCCAAAT CCCTGGGTGTTCTATGATAAGTCCTGCTTTATAACACGGGGCGGTTAGGTTAAATGACTCTTCTATCTTATGGTG ATCCAAGCGCCCGCTAATTCTGTTCTGTTAATGTTCATACCAATACTCACATCACATTAGATCAAAGGATCCCCG AGCCCAGTCGCAAGGGTCTGCTGCTGTTGTCGACGCCTCATGTTACTCCTGGAATCTACCTGCCCTCCCCTCACC GGTTAAGGCGTGTGATCGACGATGCAGGTATACATCGGCTCGGACCTACAGTGGTCGATCGACTGGCTACTGGCT TCGCGGTTCGGCGCGTAGTTGAGTGCGATAACCCAACCGGTGGCAAGTAGCAAGAAGACCTACCTGGGTCACCTT AGACAACCTAACTAATAGTCTCTAACGGGGAATTACCTTTACCAGTCTCATGCCTCCAATATATCTGCACCGCTT CAATGATATCGCCCACAGAAAGTAGGGTCTCAGGTATCGCATACGCCGCGCCCGGGTCCCAGCTACGCTCAGGAC GACAGTAGAGAGCTATTGTGTAATTCAGGCTCAGCATTCATCGACCTTTCCTGTTGTGAATATTGTGCTAATGCA TCTCGTCCGTAACGATCTGGGGGGCAAAACCGAATATCCGTATTCTCGTCCTACGGGTCCACAATGAGAAAGTCC TGCGCGTGATCGTCAGTTAAGTTAAATTAATTCAGGCTACGGTAAACTTGTAGTGAGCTAAGAATCACGGGAATC ACGGGTTCGCTACAGATGAACTGAATTTATACACGGACAACTCATCGCCCATTTGGGCGTGGGCACCGCAGATCA AAAGTGGCAGATTAGGAGTGCTTGATCAGGTTAGCAGGTGGACTGTATCCAACAGCGCATCAAACTTCAATAAAT CCAAAGCGTTGTAGTGGTCTAAGCACCCCTGAACAGTGGCGCCCATCGTTAGCGTAGTACAACCCTTCCCCCTTG AGGTGCGACATGGGGCCAGTTAGCCTGCCCTATATCCCTTGCACACGTTCAATAAGAGGGGCTCTACAGCGCCGC TTTTTAAATTAGGATGCCGACCCCATCATTGGTAACTGTATGTTCATAGATATTTCTTCAGGAGTAATAGCGACA AGCTGACACGCAAGGGTCAACAATAATTTCTACTATCACCCCGCTGAACGACTGTCTTTGCAAGAACCAACTGGG CTTAGATTCGCGTCCTAACGTAGTGAGGGCCGAGTCATATCATAGATCAGGCATGAGAAACCGACGTCGAGTCTA CACACGAGTTGTAAACAACTTGATTGCTATACTGTAGCTACCGCAAGGATCTCCTACATCAAAGACTACTGGGCG ATCTGGATCCGAGTCAGAAATACGAGTTAATGCAAATTTACGTAGACCGGTGAAAACACGTGCCATGGGTTGCGT AGACCGTAGTCAGAAGTGTGGCGCGCTATTCGTACCGAACCGGTGGAGTATACAGAATTGCTCTTCTACGACGTA AGGAGCTCGGTCCCCAATGCACGCCAAAAAAGGAATAAAGTATTCAAACTGCGCATGGTCCCTCCGCCGGTGGCA CTATTATCCATCCGAACGTTGAACCTACTTCCTCGGCTTATGCTGTCCTCAACAGTATCGCTTATGAATCGCATG CGGCTGTGGATCTTAACGGCCACATTCTTAATTCCGACCGATCACCGATCGCCTTTCCTCGCTGGTACAATGAGT ACTAAGTTATCCAGATCAAGGTTTGAACGGACTCGTATGACATGTGTGACTGAACCCGGGAGGAAATGCAGAGAA CTGTTTCAAGGCCTCTGCTTTGGTATCACTCAATATATTCAGACCAGACAAGTGGCAAAATTTCGTGCGCCTCTC CTAGGTATTCACGCAACCGTCGTAACATGCACTAAGGATAACTAGCGCCAGGGGGGCATACTAGGTCCCGGAGCT AAAGACTACCCTATGGATTCCTTGGAGCGGGGACAATGCAGACCGGTTACGACACAATTATCGGGATCGTCTAGA GGTATTATTAGCAAGACAATAAAGGACATTGCACAGAGACTTATTAGAATTCAACAAACAGGATCATATCATGCG GTGTTGGGTCGGGCAAGTCCCCGAAGCTCGGCCAAAAGATTCGCCATGGAACCGTCTGGTCCTGTTAGCGTGTAC GCCTGCTCCTGTTCCGGGTACCATAGATAGACTGAGATTGCGTCAAAAAATTGCGGCGAAAATAGAGGGGCTCCT TGTAGAAATACCAGACTGGGGAATTTAAGCGCTTTCCACTATCTGAGCGACTAAACATCAACAAATGCGTCTACT CGAATCCGCAGTAGGCAATTACAACCTGGTTCAGATCACTGGTTAATCAGGGATGTCTTCATAAGATTATACTTG CCCCGACGCGACAGCTCTTCAAGGGGCCGATTTTTGGACTTCAGATACGCTAGAATTTAAAGGGTCTCTTACACC TGCTGCGGCCTGCAGGGACCCCTAGAACTTGCCGCCTACTTGTCTCAGTCTAATAACGCGCGAAGCCGTGGGGCA CGTGACCTTAAGTCGCAGAGCGAGTGATGAATTTGGGACGCTAATATGGGTGAATAGAGACTTATATCATCAGGG CATGAACACTGTCTAGAAGATAAGCCCTAGGTTTCCTTCTCAAGGCATGGTCGTGTTACCGTATGTGCGCTCTAA AACAACCGATCGCATGTGGGCGGGGACGTAAAGGCAATGTAAAAGCGAAGGACTGTCTGAGTGCAAAACGCAAAC TACATTCCATGTTTACACCGCGAACTATCCACGCACTATGGTTCCCTTTTCACTGATTGTGCCGAGTATAGAGTA CCTCGAGAACGGAAACTTGTCTGAACGCCATGATCGTAATAGCGGTCGAAAAAAGGGACATAAAAGATCCCTCAT TGAAGACTAGATAGCATACAGGTGTAACAAACCGATACACCTAAACGTGTGGGCAGAATTTCTCATTCCCCACCG CAGGGACGGAACTCCGTTCGAAATTAACATACCGCATGTCGCGTGTTCAAAGGGAGCACATCCTAACCCACCTAT CCTACCCGGTTGCAACCCCGAACCTCAACTGAATGGCGATCAACGCTTCGTTAGCCGCTCACGTGTGGCGGGAGA GGATCGCCCAACTTTGGAAGACCTGTCTCTGTGCGCTCTATACTCCTAGGTTTATTCAATGCGCCAAAAACCATC GGCACGTACGATTAAACGACGAGCCCGACGGGGAACCTTTAAGCCATCCTTGTTATTGCAGTAGCTCAGTACTTG CACGTGATGGGGCGCGTACACTGGAGACACGTCTTGATATTTAAACCTTGCTCCAGCCCGGCTACAGCAGAAGAC CGCAACAGTCGTGCTGACCAGTTAGAAAGATGATATGTGCGCAGCTTTTAACAGGGTGCCCCGTGGAACAGTCCT GTCGACTACAAAGGATGCGTTATCAGTCCCACCATCTCAGCGTGTTCGCCCATTACTAAGCTACACGGCGCAATA GCGGGGGACGCGCCGCCCCCCGATAACGATCATGTTGGGTAGGGACAGTCACAACGGTCTCCTGTTTACTAACAA TTCATGTCAACACGCCATCTTACATGGTGTGACTGTCTAAGGGGCGGGCGGTTTCCTACAACTCCGAAGTAATTC CCTCTGTCAGTATCACAGATGCCAAAGAATTCTATCTGAACCAGCACAGCTAAAATACATGCTCCGTAGGCCACT TTCGCAAATCCAAATGCGATAATTTATCTTAAGACTGCATCTGCAAACCCAGGCCCGGGGTGATAGCTCTCATCT GAATATAACGTGTGCCAAAGCGCGTGGCCGAGCTCATTTCAAGCCAACATTCGCATGTCGTGGAAGTTCGTCACC AGGCCATAGATACTTACATAAGCCGGAAAGTACACCATCAGGCGAGCTAGTCATCACGGTTACTGGGGATTCATG CGTGGCGACTGTTCCAAAAGTTGCCATACGGCAGGACCTTTTATTTTCTGGTACAGACGTCACCGCAATCTTCTA ACTACTAACGGCGCTAAAACTCTGCGCAAGTCAGTTGGGTCTTTCTATGATATAACATGTCGTAACTGACATTAA GAGTTGCGCGTATAACTGCGAATAGACTGCATAGCTCGTCCTAGAACTATCATGGTGTACGGCATCGCTCTGACA CTTATTATTCTTGGCTCTGGCTTAATATCCCCGTCGATCCCAGCGTCTCCAAGTCGTACTTCCGTGGTTGTCATC TCATTCCCAGAGTGCGGGTCAGCGAATATCTTACGTACCCCTGCCGAAGTCGTACCCCCGAGCTTCGGTATCTCA TATAGTGTCGGCGGCACGACTGGGCTCGGGAGCTCGGAAGTTGGATAAATCATATGTGACGAGTCCAGAAAGTTC AGTATAGCCTTGGTGTTTCCAATGGTTCTCATGTCGTGGCCGAAGTCGAGCTCCTCTTAGCCCGCAGGAACAAAC GAGGGCTACGTACAGGGTTGTCAGTGTAATTAAAGTATCGCCGAGACTCTAGTCGGCAGAGAAACCAGTTGGCCT GTTCCCTTCTCTACCCGACCCTCTTACTTGTGATAATATGTACAAATTACCCGGAAAATAGAGTCGCAAATCAGA CGGCAGAAGTCGTAGTATCAGTTTATTTATTTTATCATTGACTCTGGCCGTAGTACTTTTTCGTCGGTTACCCCC TGCTGATCCTGAAACGAACCCACACGAAAGTTCTAGCGAAACAGCGGATCTGCGCCCCGTTTTGGGTACGGTGTA ATTGTACGCCTGAACTGA

This type of sequence can be a recording of some number of genes or the genome of virus.

................................................

Visualization SequencesN application

download Visualizations SequencesN application

................................................

Visualizations of quaternary, ternary and quinary numeral systems

Quaternary numeral system

Quaternary numeral system

910, 268, 279, 395, 987, 796, 987, 363, 188, 967, 133, 705, 709, 119, 423, 774, 804, 866, 777, 875, 568, 329, 495, 241, 427, 186, 337, 107, 579, 1002, 720, 480, 668, 775, 513, 967, 240, 490, 191, 887, 806, 298, 67

32032, 10030, 10113, 12023, 33123, 30130, 33123, 11223, 02330, 33013, 02011, 23001, 23011, 01313, 12213, 30012, 30210, 31202, 30021, 31223, 20320, 11021, 13233, 03301, 12223, 02322, 11101, 01223, 21003, 33222, 23100, 13200, 22130, 30013, 20001, 33013, 03300, 13222, 02333, 31313, 30212, 10222, 01003

Recalculating of decimal numeral system to quaternary numeral system:

395, 12023

4^4 + 4^3 + 4^2 + 4^1 + 4^0

256 + 64 + 16 + 4 + 1

1 + 2 + 0 + 2 + 3

256 + 128 + 0 + 8 + 3 (=395)

Quaternary numeral system

676, 142, 34, 945, 80, 727, 211, 799, 480, 926, 998, 565, 688, 269, 518, 132, 212, 467, 326, 638, 1019, 620, 296, 612, 425, 221, 815, 953, 610, 361, 29, 590, 137, 938, 786, 701, 669, 112, 214, 852, 895, 489, 587, 341, 121, 125, 619, 895, 425, 960, 224, 978, 663, 2, 878, 891, 399, 466, 370, 216, 375, 511, 384, 135, 726, 373, 632, 874, 442, 356, 553, 159, 800, 311, 179, 827, 427, 172, 237, 238, 563, 408, 735, 827, 515, 442, 674, 635, 348, 521, 690, 610, 497, 508, 520, 280, 539, 555, 778, 707, 605, 709, 411, 138, 4, 842, 871, 727, 114, 493, 685, 0, 488, 544, 164, 268, 863, 684, 443, 953, 569, 206, 738, 400, 355, 700, 1022, 251, 689

22210, 02032, 00202, 32301, 01100, 23113, 03103, 30133, 13200, 32132, 33212, 20311, 22300, 10031, 20012, 02010, 03110, 13103, 11012, 21332, 33323, 21230, 10220, 21210, 12221, 03131, 30233, 32321, 21202, 11221, 00131, 21032, 02021, 32222, 30102, 22331, 22131, 01300, 03112, 31110, 31333, 13221, 21023, 11111, 01321, 01331, 21223, 31333, 12221, 33000, 03200, 33102, 22113, 00002, 31232, 31323, 12033, 13102, 11302, 03120, 11313, 13333, 12000, 02013, 23112, 11311, 21320, 31222, 12322, 11210, 20221, 02133, 30200, 10313, 02303, 30323, 12223, 02230, 03231, 03232, 20303, 12120, 23133, 30323, 20003, 12322, 22202, 21323, 11130, 20021, 22302, 21202, 13301, 13330, 20020, 10120, 20123, 20223, 30022, 23003, 21131, 23011, 12123, 02022, 00010, 31022, 31213, 23113, 01302, 13231, 22231, 00000, 13220, 20200, 02210, 10030, 31133, 22230, 12323, 32321, 20321, 03032, 23202, 12100, 11203, 22330, 33332, 03323, 22301

Quaternary numeral system

781, 744, 537, 929, 684, 145, 490, 282, 296, 259, 450, 24, 402, 821, 450, 751, 747, 530, 728, 269, 787, 458, 788, 335, 590, 53, 332, 268, 534, 434, 839, 941, 750, 256, 678, 984, 479, 365, 414, 11, 850, 991, 479, 417, 505, 26, 171, 571, 371, 179, 114, 102, 348, 303, 264, 377, 639, 682, 182, 939, 208, 129, 333, 50, 483, 873, 369, 619, 150, 631, 837, 528, 909, 608, 689, 826, 332, 145, 613, 81, 374, 105, 989, 700, 20, 542, 895, 77, 99, 938, 787, 81, 507, 321, 446, 69, 1007, 946, 438, 258, 668, 45, 213, 629, 465, 469, 583, 177, 521, 669, 122, 608, 95, 458, 894, 386, 496, 924, 281, 91, 88, 652, 156, 400, 511, 894, 461, 862, 484

30031, 23220, 20121, 32201, 22230, 02101, 13222, 10122, 10220, 10003, 13002, 00120, 12102, 30311, 13002, 23233, 23223, 20102, 23120, 10031, 30103, 13022, 30110, 11033, 21032, 00311, 11030, 10030, 20112, 12302, 31013, 32231, 23232, 10000, 22212, 33120, 13133, 11231, 12132, 00023, 31102, 33133, 13133, 12201, 13321, 00122, 02223, 20323, 11303, 02303, 01302, 01212, 11130, 10233, 10020, 11321, 21333, 22222, 02312, 32223, 03100, 02001, 11031, 00302, 13203, 31221, 11301, 21223, 02112, 21313, 31011, 20100, 32031, 21200, 22301, 30322, 11030, 02101, 21211, 01101, 11312, 01221, 33131, 22330, 00110, 20132, 31333, 01031, 01203, 32222, 30103, 01101, 13323, 11001, 12332, 01011, 33233, 32302, 12312, 10002, 22130, 00231, 03111, 21311, 13101, 13111, 21013, 02301, 20021, 22131, 01322, 21200, 01133, 13022, 31332, 12002, 13300, 32130, 10121, 01123, 01120, 22030, 02130, 12100, 13333, 31332, 13031, 31132, 13210

The alien (cosmic) signs forming in the above images are derived from an alien numeral system. An interesting fact is that these alien signs are formed out of chance, a random process. This is an example of order emerging from random process.
In the case of these signs, chance speaks to us in some alien language. Let me describe this language as the language of God the Father. So in the case of this visualization, chance speaks to us in the language of God the Father.
The chance undergoes ordering processes, hence it may, under certain conditions, lead to the emergence of order. Similarly, chaos undergoes ordering processes and leads to the emergence of order. An example are fractals.
The discovery of great importance, which is illustrated in the above diagrams, is the fact that pure chance is also subject to ordering processes (the issue of indeterministic chaos is dealt with in this text: New horizons in physics). A certain order is introduced into pure chance by God.
I propose replacing the current 26 characters Latin alphabet with a new set of 26 characters. You can use my app for this purpose (see below 3 rows app). The new signs would correspond to the old sounds, only the letter writing would change. In this way, our language would become similar to the language of God the Father.

(The above paragraph is from year 2023 and 2024)

................................................

Ternary numeral system

Ternary numeral system

34, 158, 217, 39, 233, 161, 234, 202, 137, 88, 53, 177, 44, 222, 71, 157, 118, 233, 138, 53, 9, 200, 237, 92, 156, 57, 67, 46, 209, 173, 163, 110, 22, 16, 225, 134, 8, 143, 55, 89, 122, 11, 126

01021, 12212, 22001, 01110, 22122, 12222, 22200, 21111, 12002, 10021, 01222, 20120, 01122, 22020, 02122, 12211, 11101, 22122, 12010, 01222, 00100, 21102, 22210, 10102, 12210, 02010, 02111, 01201, 21202, 20102, 20001, 11002, 00211, 00121, 22100, 11222, 00022, 12022, 02001, 10022, 11112, 00102, 11200

Recalculating of decimal numeral system to ternary numeral system:

143, 12022

3^4+ 3^3+ 3^2+ 3^1+ 3^0

81 + 27 + 9 + 3 + 1

1 + 2 + 0 + 2 + 2

81 + 54 + 0 + 6 + 2 (=143)

Ternary numeral system

217, 180, 204, 230, 6, 121, 33, 60, 34, 12, 159, 103, 108, 60, 192, 160, 142, 191, 0, 228, 233, 214, 45, 206, 46, 188, 50, 127, 64, 188, 237, 24, 59, 204, 67, 65, 116, 214, 70, 195, 166, 85, 102, 45, 99, 189, 226, 149, 172, 68, 110, 30, 10, 66, 105, 142, 170, 206, 241, 173, 89, 141, 217, 111, 114, 175, 110, 97, 135, 11, 159, 231, 197, 189, 209, 135, 97, 107, 184, 37, 86, 107, 124, 147, 19, 201, 61, 222, 184, 133, 91, 66, 61, 238, 65, 99, 48, 198, 94, 198, 111, 86, 230, 156, 37, 210, 120, 106, 199, 155, 42, 24, 133, 187, 131, 148, 16, 210, 22, 103, 38, 52, 234, 148, 209, 21, 112, 40, 86

22001, 20200, 21120, 22112, 00020, 11111, 01020, 02020, 01021, 00110, 12220, 10211, 11000, 02020, 21010, 12221, 12021, 21002, 00000, 22110, 22122, 21221, 01200, 21122, 01201, 20222, 01212, 11201, 02101, 20222, 22210, 00220, 02012, 21120, 02111, 02102, 11022, 21221, 02121, 21020, 20011, 10011, 10210, 01200, 10200, 21000, 22101, 12112, 20101, 02112, 11002, 01010, 00101, 02110, 10220, 12021, 20022, 21122, 22221, 20102, 10022, 12020, 22001, 11010, 11020, 20111, 11002, 10121, 12000, 00102, 12220, 22120, 21022, 21000, 21202, 12000, 10121, 10222, 20211, 01101, 10012, 10222, 11121, 12110, 00201, 21110, 02021, 22020, 20211, 11221, 10101, 02110, 02021, 22211, 02102, 10200, 01210, 21100, 10111, 21100, 11010, 10012, 22112, 12210, 01101, 21210, 11110, 10221, 21101, 12202, 01120, 00220, 11221, 20221, 11212, 12111, 00121, 21210, 00211, 10211, 01102, 01221, 22200, 12111, 21202, 00210, 11011, 01111, 10012

................................................

Quinary numeral system

Quinary numeral system

1029, 1070, 2715, 2857, 18, 53, 942, 1189, 2699, 74, 879, 2627, 395, 2874, 1748, 1962, 299, 511, 2850, 2504, 2177, 840, 320, 2764, 2656, 331, 1768, 749, 103, 444, 2533, 5, 1988, 2111, 2386, 2323, 3076, 1097, 1704, 928, 356, 1601, 1290

13104, 13240, 41330, 42412, 00033, 00203, 12232, 14224, 41244, 00244, 12004, 41002, 03040, 42444, 23443, 30322, 02144, 04021, 42400, 40004, 32202, 11330, 02240, 42024, 41111, 02311, 24033, 10444, 00403, 03234, 40113, 00010, 30423, 31421, 34021, 33243, 44301, 13342, 23304, 12203, 02411, 22401, 20130

Recalculating of decimal numeral system to quinary numeral system:

1704, 23304

5^4+ 5^3+ 5^2+ 5^1+ 5^0

625 + 125 + 25 + 5 + 1

2 + 3 + 3 + 0 + 4

1250 + 375 + 75 + 0 + 4 (=1704)

................................................

Visualization numeral systems application

download Visualizations NumeralS application

download Visualizations NumeralS 3 rows in the same system, application

................................................

Gregory Podgorniak, Poland (year 2015 nucleotide sequence, year 2010 numeral systems)

Comte's Theory of Science

Comte's Theory of Science

According to him whole of sciences consists of theoretical and applied knowledge. Theoretical knowledge divide on general fields as physics or biology, which are an object of his research and detailed such as botany, zoology or mineralogy. Main fields mathematics, astronomy, physics, chemistry, biology and sociology it is possible to order according to decrescent range of research and complicatedness of theoretical tools what is connected with growing complexity of investigated phenomenones. Following sciences are based on previous, for example to methodically capture chemistry, we must imply acquaintance of physics, because all chemical phenomena are more complicated than physical phenomena, are also from them dependent and themselves do not have on them an influence. Similarly sciences classified as earlier, are older and more advanced from these which are presented as later. This theory is clearly analogous to Mariotte's Law.

Mariotte's Law

Edme Mariotte (1620-1684) French physicist, meteorologist, physiologist. He initiated meteorological research and measurement. In his Discourse on the Nature of Air (1676) coined the word barometer and formulate basic tenet of physics called Mariotte's law states that at constant temperature T volume V of a given quantity of gas is inversely proportional as its pressure p:

pV = constant

its graph is hyperbole:

pV = const = nrT

p = rT / V

Mariotte's Law'

Gregory Podgorniak in 2005 about the author, My name is Gregory Podgorniak (brn. 01.1977, Szczecinek, West Pomerania, Poland). I am working on field of natural as well as social sciences. During philosophical studies at Adam Mickiewicz University in Poznan (1996-1999) I was actively act in student scientific organisation, got a scientific scholarship, and one from my articles titled Circulus vitiosus and fourfold petitio principii in the system of Descartes was published in Humanistic Drafts of Publishing House of Humaniora Foundation in Poznan, no. 6, 1998. Unfortunately certain fate events made impossible to me continuing studies to master's and later doctor's degree. Thence I was forced to be content only with a title of bachelor.
Thanks to deep and penetrating researchings I was able to establish indisputably some number of my past incarnations reaching of ancient period, these data are certain, these incarnations are: Auguste Comte (1798-1857) French philosopher and sociologist, Edme Mariotte (1620-1684) French physicist and meteorologist, Bodhidharma (5th or 6th century) buddhist patriarch, Aenesidemus (1 st century BC) Greek sceptical philosopher, Arcesilaus (315-241 BC) Greek sceptical philosopher, Gorgias (485-380 BC) Greek sophist.

email contact: podgorniakgre@gmail.com

appendix 1

photo of the soul

Photograph of the subtle body obtained using a special UV filter, the author of the photo probably was not aware of the obtained result. I discovered this photo by accident, by searching images of ultraviolet photography, around the year 2005. Colors are different than on photographs in visible light what is natural for UV photography. This photo is proof of the existence of the soul.

appendix 2

Solution of the problem of Wave-particle duality

One of the biggest puzzles is the problem of how light in classical physics can be a wave, while in quantum physics it is in the form of photons or particles. The light ray is a wave but the energy transmits matter in the form of photons. Thus, it can also be assumed that any other particle, for example a moving electron, can be a wave of matter. The existence of matter waves was confirmed in 1927. Also in 1927 the uncertainty principle was formulated, stating that it is impossible to measure the position and momentum of a particle with unlimited accuracy. The issues considered are related to the problem of wave-particle duality.
Wave-particle duality, the property of matter, for example electrons, in that in some conditions the wave character is manifested, and in others corpuscular character. Wave properties are revealed by diffraction and interference phenomena. Classical physics could not explain, for example, the photoelectric phenomenon, the adoption of the concept of a discrete radiation structure enabled solving this difficulty. Electron diffraction has shown that molecules have wave properties in addition to their corpuscular properties. Current theory assumes that all molecules have both wave and corpuscular character. This fact has been checked not only for elementary particles but also for composite particles such as atoms. Recognition of the dual nature of matter is the basis of modern physics.
So far, considered duality remains a mystery, this is my explanation of this enigma. The problem of wave-particle duality is in fact a problem of trichotomy, where the third state are fields. At the explanation of this problem it is possible to invoke phenomenon of three states of concentration of the matter, the solid state, liquid and gas. This phenomenon determines the model for the problem of trichotomy in the microworld. Three states of concentration of the matter it is possible to implement by the fourth state which is the vacuum. These considerations make for the conclusion that the base for three states of the microworld is the vacuum. So particles, waves and fields are just a condensed form of vacuum (space). On the ground of STM (see paragraph 1) we can reach explanation where particles, waves and fields can be brought to the space.
The vacuum or space itself is in three states, the firstfruits of particle, wave and field matter. First we have the firstfruits of particle matter, the square microgrid, which is what the particles are made of. Later we have the firstfruits of wave matter - asymmetric microgrid, waves are made of it. Then the firstfruits of field matter, straight parallel lines, from which the fields are composed. It can be said that these firstfruits of fields are themselves a field, and the vacuum (space) itself is a field.
So it appears that matter is simply of a threefold nature, because the space from which it arises has a threefold nature. There are three microgrids, a particle microgrid, a wave microgrid, and a field microgrid.

more in my text: New horizons in physics

map of my research

16618